Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08551

HP ID(1) HP08551
Gene ID(2) 5143
Gene Symbol finder PDE4C
Protein Name phosphodiesterase 4C, cAMP-specific (phosphodiesterase E1 dunce homolog, Drosophila)
RefSeq NM_000923.3
Length of RefSeq (bp) 5346
Chromosome 19p13.11
Reference DDBJ accession
UniGene Hs.132584

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd63G04 pGCAP10 GCAGTTCCACCTTCTACCGCTTCAGCACCTCCGGCGCGGACAGCTCCTCGCTGTCGCCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl