Prev. |  KEGG KO K13293 > 

RIKEN DNA Bank Human Resource - PDE4C

Gene ID NCBI Gene 5143 |  KEGG hsa:5143
Gene Symbol PDE4C
Protein Name phosphodiesterase 4C
Synonyms DPDE1|PDE21
Ortholog resources KEGG ortholog (KEGG orthology K13293) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR385348 RBd63G04 pGCAP10 NM_000923.3  
GCAGTTCCACCTTCTACCGCTTCAGCACCTCCGGCGCGGACAGCTCCTCGCTGTCGCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl