Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08542

HP ID(1) HP08542
Gene ID(2) 4914
Gene Symbol finder NTRK1
Protein Name neurotrophic tyrosine kinase, receptor, type 1
RefSeq NM_002529.3
Length of RefSeq (bp) 2663
Chromosome 1q21-q22
Reference DDBJ accession
UniGene Hs.406293

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd62F02 pGCAP10 GAGACGGCTGCCCCGCCTGAGCGAGGCGGGCGCCGCCGCGATGCTGCGAGGCGGACGGCG
RBdS014E11 pGCAP10 GATGTCGGGGGAGGCCTGGCAGCTGCAGCTGGGAGCGCACAGACGGCTGCCCCGCCTGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl