Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NTRK1

Gene ID (NCBI) 4914
Gene Symbol NTRK1
Protein Name neurotrophic receptor tyrosine kinase 1
Synonyms MTC|TRK|TRK1|TRKA|Trk-A|p140-TrkA
Databases KEGG hsa:4914 |  NCBI Gene 4914
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03176)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR384922 RBd62F02 pGCAP10 NM_002529.3 done
GAGACGGCTGCCCCGCCTGAGCGAGGCGGGCGCCGCCGCGATGCTGCGAGGCGGACGGCG
HKR405707 RBdS014E11 pGCAP10 NM_002529.3 done
GATGTCGGGGGAGGCCTGGCAGCTGCAGCTGGGAGCGCACAGACGGCTGCCCCGCCTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl