Prev. |  KEGG KO K03176 > 

RIKEN DNA Bank Human Resource - NTRK1

Gene ID NCBI Gene 4914 |  KEGG hsa:4914
Gene Symbol NTRK1
Protein Name neurotrophic receptor tyrosine kinase 1
Synonyms MTC|TRK|TRK1|TRKA|Trk-A|p140-TrkA
Featured content Endocytosis (human)
Featured content Apoptosis - human
Ortholog resource in our bank

  NTRK1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405707 RBdS014E11 pGCAP10 NM_001012331.2 done
GATGTCGGGGGAGGCCTGGCAGCTGCAGCTGGGAGCGCACAGACGGCTGCCCCGCCTGAG
HKR384922 RBd62F02 pGCAP10 NM_001012331.2 done
GAGACGGCTGCCCCGCCTGAGCGAGGCGGGCGCCGCCGCGATGCTGCGAGGCGGACGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl