Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08541

HP ID(1) HP08541
Gene ID(2) 27433
Gene Symbol finder TOR2A
Protein Name torsin family 2, member A
RefSeq NM_130459.2
Length of RefSeq (bp) 2509
Chromosome 9q34.11
Reference DDBJ accession
UniGene Hs.444106

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd62E09 pGCAP10 GAGTTGACTGCCCCACAACGAGCTCGGGCCTCACCCGGATGGCGGCTGCGACGCGCGGCT
RBd93G05 pGCAP10 TACAACGAGCTCGGGCCTCACCCGGATGGCGGCTGCGACGCGCGGCTGCCGGCCCTGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl