Prev. | 

RIKEN DNA Bank Human Resource - TOR2A

Gene ID NCBI Gene 27433 |  KEGG hsa:27433
Gene Symbol TOR2A
Protein Name torsin family 2 member A
Synonyms TORP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX016956 IRAK042G12 pCMV-SPORT6 BC022985 NM_130459 Partial/var
HGY100304 IRAL050M16 pOTB7 BC062340 NM_130459 Partial/var
HGY103665 IRAL059C17 pOTB7 BC080527 NM_130459 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR384905 RBd62E09 pGCAP10 NM_130459.2  
GAGTTGACTGCCCCACAACGAGCTCGGGCCTCACCCGGATGGCGGCTGCGACGCGCGGCT
HKR397349 RBd93G05 pGCAP10 NM_130459.2  
TACAACGAGCTCGGGCCTCACCCGGATGGCGGCTGCGACGCGCGGCTGCCGGCCCTGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl