Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08537

HP ID(1) HP08537
Gene ID(2) 10277
Gene Symbol finder UBE4B
Protein Name ubiquitination factor E4B (UFD2 homolog, yeast)
RefSeq NM_006048.3
Length of RefSeq (bp) 5556
Chromosome 1p36.3
Reference DDBJ accession
UniGene Hs.632370

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd62D06 pGCAP10 CCGGCCTGCTTTGGGAGGGGAGGGGCTTCCCTTACAGTGCTGGGCTCTGCCAGGACGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl