Prev. |  KEGG KO K10597 > 

RIKEN DNA Bank Human Resource - UBE4B

Gene ID NCBI Gene 10277 |  KEGG hsa:10277
Gene Symbol UBE4B
Protein Name ubiquitination factor E4B
Synonyms E4|HDNB1|UBOX3|UFD2|UFD2A
Ortholog resources KEGG ortholog (KEGG orthology K10597) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR384878 RBd62D06 pGCAP10 NM_006048.3  
CCGGCCTGCTTTGGGAGGGGAGGGGCTTCCCTTACAGTGCTGGGCTCTGCCAGGACGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl