Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08524

HP ID(1) HP08524
Gene ID(2) 144608
Gene Symbol finder C12orf60
Protein Name chromosome 12 open reading frame 60
RefSeq NM_175874.3
Length of RefSeq (bp) 1139
Chromosome 12p12.3
Reference DDBJ accession
UniGene Hs.659951

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd60D07 pGCAP10 GAGATAGCTGCTAACTGAGTGGCTGACGGTCCTGTCTCTCGAGTTGGAGGCATCTTGACT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl