Prev. | 

RIKEN DNA Bank Human Resource - C12orf60

Gene ID NCBI Gene 144608 |  KEGG hsa:144608
Gene Symbol C12orf60
Protein Name chromosome 12 open reading frame 60
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX032861 IRAK082C13 pCMV-SPORT6 BC038836 NM_175874
HGY096598 IRAL041I06 pDNR-LIB BC029443 NM_175874 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE094445 M01C036B21 pDONR221 MGC07-G11 BC038836 ENST00000330828  
HGE094493 M01C036D21 pDONR221 MGC07-G11 BC038836 ENST00000330828  
HGE094541 M01C036F21 pDONR221 MGC07-G11 BC038836 ENST00000330828  
HGE094589 M01C036H21 pDONR221 MGC07-G11 BC038836 ENST00000330828  
HGE094637 M01C036J21 pDONR221 MGC07-G11 BC038836 ENST00000330828  
HGE094685 M01C036L21 pDONR221 MGC07-G11 BC038836 ENST00000330828  
HGE094733 M01C036N21 pDONR221 MGC07-G11 BC038836 ENST00000330828  
HGE094781 M01C036P21 pDONR221 MGC07-G11 BC038836 ENST00000330828  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR384079 RBd60D07 pGCAP10 NM_175874.3  
GAGATAGCTGCTAACTGAGTGGCTGACGGTCCTGTCTCTCGAGTTGGAGGCATCTTGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl