Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08484

HP ID(1) HP08484
Gene ID(2)
Gene Symbol finder RAB4A(upstream, opposite)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp)
Chromosome 1q42-q43
Reference DDBJ accession
UniGene Hs.568464

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd54A10 pGCAP10 GGCGTGAGGACTTCGGCGCGCGCCGGAAGCACGTGCGCGGGCTGGGCGCTCTGGCGGTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl