Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08452

HP ID(1) HP08452
Gene ID(2) 6904
Gene Symbol finder TBCD
Protein Name tubulin folding cofactor D
RefSeq NM_005993.4
Length of RefSeq (bp) 4449
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.464391

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd49H02 pGCAP10 GATCCTTCATCCCTGGCTTTCGCGCTCTAGCGGAGTGGGATCTGCGAACACGTGAGGCGG
RBd69A05 pGCAP10 GGCGCTCTAGCGGAGTGGGATCTGCGAACACGTGAGGCGGGGGCGCGGTCCCCAGGCTGC
RBdS070J14 pGCAP10 GGCCAGCGTCGGTTGCCGCCTTAGCGGGCGCCTCCTTTTCATCCCTCATCCTTCATCCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl