Prev. | 

RIKEN DNA Bank Human Resource - TBCD

Gene ID NCBI Gene 6904 |  KEGG hsa:6904
Gene Symbol TBCD
Protein Name tubulin folding cofactor D
Synonyms PEBAT|SSD-1|tfcD
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082584 IRAL006H16 pOTB7 BC003094 NM_005993 Full/var
HGY084215 IRAL010I23 pOTB7 BC012824 NM_005993 Partial/var
HGY087004 IRAL017I12 pOTB7 BC006364 NM_005993 Full/var
HGY097387 IRAL043H19 pOTB7 BC039654 NM_005993 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR379770 RBd49H02 pGCAP10 NM_005993.4  
GATCCTTCATCCCTGGCTTTCGCGCTCTAGCGGAGTGGGATCTGCGAACACGTGAGGCGG
HKR387605 RBd69A05 pGCAP10 NM_005993.4  
GGCGCTCTAGCGGAGTGGGATCTGCGAACACGTGAGGCGGGGGCGCGGTCCCCAGGCTGC
HKR428230 RBdS070J14 pGCAP10 NM_005993.4  
GGCCAGCGTCGGTTGCCGCCTTAGCGGGCGCCTCCTTTTCATCCCTCATCCTTCATCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl