Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08447

HP ID(1) HP08447
Gene ID(2) 22889
Gene Symbol finder KIAA0907
Protein Name KIAA0907
RefSeq NM_014949.2
Length of RefSeq (bp) 2960
Chromosome 1q22
Reference DDBJ accession
UniGene Hs.719258

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd49C09 pGCAP10 GGGTCGCCATGTCCGCGGGGAGCGCGACACATCCTGGAGCTGGCGGGCGCCGCAGCAAAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl