Prev. | 

RIKEN DNA Bank Human Resource - KHDC4

Gene ID NCBI Gene 22889 |  KEGG hsa:22889
Gene Symbol KHDC4
Protein Name KH domain containing 4, pre-mRNA splicing factor
Synonyms BLOM7|KIAA0907|SNORA80EHG
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR379657 RBd49C09 pGCAP10 NM_014949.2 done
GGGTCGCCATGTCCGCGGGGAGCGCGACACATCCTGGAGCTGGCGGGCGCCGCAGCAAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl