Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08443

HP ID(1) HP08443
Gene ID(2) 343450
Gene Symbol finder KCNT2
Protein Name potassium channel, subfamily T, member 2
RefSeq NM_198503.2
Length of RefSeq (bp) 5909
Chromosome 1q31.3
Reference DDBJ accession
UniGene Hs.657046

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd48E12 pGCAP10 GCCCTCTCTCTCTCGGCCACAGCGTCTTGTTAGTCCTCTCCCTGTACTCCGCAATATTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl