Prev. |  KEGG KO K04947 > 

RIKEN DNA Bank Human Resource - KCNT2

Gene ID NCBI Gene 343450 |  KEGG hsa:343450
Gene Symbol KCNT2
Protein Name potassium sodium-activated channel subfamily T member 2
Synonyms EIEE57|KCa4.2|SLICK|SLO2.1
Ortholog resource in our bank

  KCNT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR379308 RBd48E12 pGCAP10 NM_198503.2 done
GCCCTCTCTCTCTCGGCCACAGCGTCTTGTTAGTCCTCTCCCTGTACTCCGCAATATTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl