Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08423

HP ID(1) HP08423
Gene ID(2) 9618
Gene Symbol finder TRAF4
Protein Name TNF receptor-associated factor 4
RefSeq NM_004295.3
Length of RefSeq (bp) 2902
Chromosome 17q11.2
Reference DDBJ accession
UniGene Hs.8375

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd46A02 pGCAP10 GACAGCCGAGCCCTGGCCGCGACCGCCAGTCGGCGCCGCCCGGAGCCGGGAGCGCCGCTC
RBd63C10 pGCAP10 GAGTCGNCGCCGCCCGGAGCCGGGAGCGCCGCTCCAGCGAGGCGCGGGCTGTGGGGCCGC
RBd82E04 pGCAP10 GAGTCGGCGCCGCCCGGAGCCGGGAGCGCCGCTCCAGCGAGGCGCGGGCTGTGGGGCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl