Prev. |  KEGG KO K09848 > 

RIKEN DNA Bank Human Resource - TRAF4

Gene ID NCBI Gene 9618 |  KEGG hsa:9618
Gene Symbol TRAF4
Protein Name TNF receptor associated factor 4
Synonyms CART1|MLN62|RNF83
Ortholog resource in our bank

  TRAF4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03588 pAxCALNLhTRAF4 (forward) Shuttle vector to generate rAd harboring human TRAF4 (forward)
RDB04155 pAxCALNLhTRAF4 (reverse) Shuttle vector to generate rAd harboring human TRAF4
RDB04983 pAxCALNLhTRAF4(forward) Shuttle vector to generate rAd expressing human TRAF4
RDB04984 pAxCALNLhTRAF4(reverse) Shuttle vector to generate rAd expressing human TRAF4

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082769 IRAL006P09 pOTB7 BC001769 NM_004295 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037616 W01A094A16 pENTR-TOPO IRAL006P09 BC001769 NM_004295  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR378402 RBd46A02 pGCAP10 NM_004295.3  
GACAGCCGAGCCCTGGCCGCGACCGCCAGTCGGCGCCGCCCGGAGCCGGGAGCGCCGCTC
HKR385258 RBd63C10 pGCAP10 NM_004295.3  
GAGTCGNCGCCGCCCGGAGCCGGGAGCGCCGCTCCAGCGAGGCGCGGGCTGTGGGGCCGC
HKR392900 RBd82E04 pGCAP10 NM_004295.3  
GAGTCGGCGCCGCCCGGAGCCGGGAGCGCCGCTCCAGCGAGGCGCGGGCTGTGGGGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl