Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08359

HP ID(1) HP08359
Gene ID(2) 10140
Gene Symbol finder TOB1
Protein Name transducer of ERBB2, 1
RefSeq NM_005749.2
Length of RefSeq (bp) 1830
Chromosome 17q21
Reference DDBJ accession
UniGene Hs.653129

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd76G09 pGCAP10 GAGAAGGAGCGAAGCTCTGGCCCGGCGTGTAGCGGGCGCACTACGGGGACGCTGGGCCGG
RBdS015D13 pGCAP10 TTTGAGAAGGAGCGAAGCTCTGGCCCGGCGTGTAGCGGGCGCACTACGGGGACGCTGGGC
RBdS105D05 pGCAP10 TTTTTTTTTTTTTTTTTTTTTTGGTGGGGGAGTTGAAACCTAATTTTGTGGCGTAGCAGC
RBdS154G19 pGCAP10 AGAAGGAGCGAAGCTCTGGCCCGGCGTGTAGCGGGCGCACTACGGGGACGCTGGGCCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl