Prev. |  KEGG KO K14443 > 

RIKEN DNA Bank Human Resource - TOB1

Gene ID NCBI Gene 10140 |  KEGG hsa:10140
Gene Symbol TOB1
Protein Name transducer of ERBB2, 1
Synonyms APRO5|APRO6|PIG49|TOB|TROB|TROB1
Ortholog resource in our bank

  TOB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02857 pBS-human Tob cDNA clone of human TOB1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020303 IRAK050M15 pCMV-SPORT6 BC031406 NM_005749 Full
HGX069951 IRAK174O15 pCMV-SPORT6 BC070493 NM_005749 Full
HGY087757 IRAL019G13 pDNR-LIB BC015064 NM_005749 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001465 W01A003L01 pENTR-TOPO IRAK050M15 BC031406 NM_005749  
HGE001467 W01A003L03 pENTR-TOPO IRAK050M15 BC031406 NM_005749  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR390553 RBd76G09 pGCAP10 NM_005749.2  
GAGAAGGAGCGAAGCTCTGGCCCGGCGTGTAGCGGGCGCACTACGGGGACGCTGGGCCGG
HKR406085 RBdS015D13 pGCAP10 NM_005749.2  
TTTGAGAAGGAGCGAAGCTCTGGCCCGGCGTGTAGCGGGCGCACTACGGGGACGCTGGGC
HKR442077 RBdS105D05 pGCAP10 NM_005749.2  
TTTTTTTTTTTTTTTTTTTTTTGGTGGGGGAGTTGAAACCTAATTTTGTGGCGTAGCAGC
HKR461763 RBdS154G19 pGCAP10 NM_005749.2  
AGAAGGAGCGAAGCTCTGGCCCGGCGTGTAGCGGGCGCACTACGGGGACGCTGGGCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl