Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08310

HP ID(1) HP08310
Gene ID(2) 8566
Gene Symbol finder PDXK
Protein Name pyridoxal (pyridoxine, vitamin B6) kinase
RefSeq NM_003681.4
Length of RefSeq (bp) 7390
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.284491

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS051G05 pGCAP10 GGTCTGCGCTGATCGGGTCCGCCGCGCGCCAGAGCCAGAGTCGCAGCCGAGGGGAGCCGG
RBdS075B04 pGCAP10 GCAGCCCCCGGCGCCGCGCGGAACTCGCGGGTTCGGAGCCGCCCGCTGAGGTCAGAAGGA
RBdS104E22 pGCAP10 GAGCCCCCGGCGCCGCGCGGAACTCGCGGGTTCGGAGCCGCCCGCTGAGGTCAGAAGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl