Prev. |  KEGG KO K00868 > 

RIKEN DNA Bank Human Resource - PDXK

Gene ID NCBI Gene 8566 |  KEGG hsa:8566
Gene Symbol PDXK
Protein Name pyridoxal kinase
Synonyms C21orf124|C21orf97|HEL-S-1a|HMSN6C|PKH|PNK|PRED79
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  PDXK

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081412 IRAL003I20 pOTB7 BC005825 NM_003681 Full/var
HGY082415 IRAL006A15 pOTB7 BC000123 NM_003681 Full
HGY084460 IRAL011C12 pOTB7 BC003651 NM_003681 Partial/var
HGY089356 IRAL023G12 pOTB7 BC008008 NM_032920 Full
HGY096341 IRAL040O05 pOTB7 BC021550 NM_032920 Full
HGY097619 IRAL044A19 pOTB7 BC041020 NM_032920 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR420549 RBdS051G05 pGCAP10 NM_003681.4  
GGTCTGCGCTGATCGGGTCCGCCGCGCGCCAGAGCCAGAGTCGCAGCCGAGGGGAGCCGG
HKR430028 RBdS075B04 pGCAP10 NM_003681.4  
GCAGCCCCCGGCGCCGCGCGGAACTCGCGGGTTCGGAGCCGCCCGCTGAGGTCAGAAGGA
HKR441718 RBdS104E22 pGCAP10 NM_003681.4  
GAGCCCCCGGCGCCGCGCGGAACTCGCGGGTTCGGAGCCGCCCGCTGAGGTCAGAAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl