Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08232

HP ID(1) HP08232
Gene ID(2) 9104
Gene Symbol finder RGN
Protein Name regucalcin (senescence marker protein-30)
RefSeq NM_004683.4
Length of RefSeq (bp) 1635
Chromosome Xp11.3
Reference DDBJ accession
UniGene Hs.77854

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS194I21 pGCAP10 GAGGCCCCGGCGACAACAGAGCCAGACCCGCTCATCCCGATCTCCCAGAAGGCGACTGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl