Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08226

HP ID(1) HP08226
Gene ID(2) 5923
Gene Symbol finder RASGRF1
Protein Name Ras protein-specific guanine nucleotide-releasing factor 1
RefSeq NM_153815.1
Length of RefSeq (bp) 2843
Chromosome 15q24
Reference DDBJ accession
UniGene Hs.591111

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS194G04 pGCAP10 GCTCTCTAAGGATGAGGCCAGAGAGTGTAGGCGGGAGCAGGCCCTGTGTGGGATGGAGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl