Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08223

HP ID(1) HP08223
Gene ID(2) 79576
Gene Symbol finder NKAP
Protein Name NF-kappaB activating protein
RefSeq NM_024528.2
Length of RefSeq (bp) 1608
Chromosome Xq24
Reference DDBJ accession
UniGene Hs.522771

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS194E03 pGCAP10 GTCCTGTCGGTGACGACCGCCTAGATCCGGGGAAGGGTTTTGCAGAAGTACCCAGAACTG
RBd76H01 pGCAP10 GGCAGAAGTACCCAGAACTGTGTCCAAGGTTTCCTCAGATTTGGGCTGTTCCGCAGCGGC
RBd90A06 pGCAP10 GGCAGAAGTACCCAGAACTGTGTCCAAGGTTTCCTCAGATTTGGGCTGTTCCGCAGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl