Prev. | 

RIKEN DNA Bank Human Resource - NKAP

Gene ID NCBI Gene 79576 |  KEGG hsa:79576
Gene Symbol NKAP
Protein Name NFKB activating protein
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001394 IRAK003I02 pCMV-SPORT6 BC000940 NM_024528 Full/var
HGX008016 IRAK020A16 pCMV-SPORT6 BC015354 NM_024528 Full/var
HGX025680 IRAK064D08 pCMV-SPORT6 BC032442 NM_024528 Full/var
HGX066518 IRAK166E22 pCMV-SPORT6 BC071686 NM_024528 Partial/var
HGY089674 IRAL024D02 pOTB7 BC012770 NM_024528 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR277699 ARiS194E03 pGCAP10 NM_024528.2  
GTCCTGTCGGTGACGACCGCCTAGATCCGGGGAAGGGTTTTGCAGAAGTACCCAGAACTG
HKR390569 RBd76H01 pGCAP10 NM_024528.2  
GGCAGAAGTACCCAGAACTGTGTCCAAGGTTTCCTCAGATTTGGGCTGTTCCGCAGCGGC
HKR396006 RBd90A06 pGCAP10 NM_024528.2  
GGCAGAAGTACCCAGAACTGTGTCCAAGGTTTCCTCAGATTTGGGCTGTTCCGCAGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl