Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08209

HP ID(1) HP08209
Gene ID(2) 1787
Gene Symbol finder TRDMT1
Protein Name tRNA aspartic acid methyltransferase 1
RefSeq NM_004412.4
Length of RefSeq (bp) 7281
Chromosome 10p15.1
Reference DDBJ accession
UniGene Hs.351665

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191M13 pGCAP10 GGGGGCTGCGGCGGCTGAGGCGCGGGGATGGAGCCCCTGCGGGTGCTGGAGCTATACAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl