Prev. |  KEGG KO K15336 > 

RIKEN DNA Bank Human Resource - TRDMT1

Gene ID NCBI Gene 1787 |  KEGG hsa:1787
Gene Symbol TRDMT1
Protein Name tRNA aspartic acid methyltransferase 1
Synonyms DMNT2|DNMT2|MHSAIIP|PUMET|RNMT1
Ortholog resource in our bank

  TRDMT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX039573 IRAK098P13 pCMV-SPORT6 BC047733 NM_176086 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006506 W01A016E10 pENTR-TOPO IRAK098P13 BC047733 NM_176086  
HGE006508 W01A016E12 pENTR-TOPO IRAK098P13 BC047733 NM_176086  
HGE006510 W01A016E14 pENTR-TOPO IRAK098P13 BC047733 NM_176086  
HGE006512 W01A016E16 pENTR-TOPO IRAK098P13 BC047733 NM_176086  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276701 ARiS191M13 pGCAP10 NM_004412.4  
GGGGGCTGCGGCGGCTGAGGCGCGGGGATGGAGCCCCTGCGGGTGCTGGAGCTATACAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl