Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08195

HP ID(1) HP08195
Gene ID(2) 5707
Gene Symbol finder PSMD1
Protein Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
RefSeq NM_002807.2
Length of RefSeq (bp) 3227
Chromosome 2q37.1
Reference DDBJ accession
UniGene Hs.3887

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191F15 pGCAP10 GGGAGGCGACTGACTGAGCAGCGCACCCGGGGAGCAAGGAGGCGCGGTGAACTGAGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl