Prev. |  KEGG KO K03032 > 

RIKEN DNA Bank Human Resource - PSMD1

Gene ID NCBI Gene 5707 |  KEGG hsa:5707
Gene Symbol PSMD1
Protein Name proteasome 26S subunit, non-ATPase 1
Synonyms P112|Rpn2|S1
Ortholog resource in our bank

  PSMD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033761 IRAK084G17 pCMV-SPORT6 BC039845 NM_002807 Partial/var
HGX042833 IRAK107B09 pCMV-SPORT6 BC047897 NM_002807 Partial/var
HGX055602 IRAK139A02 pCMV-SPORT6 BC064398 NM_002807 Partial/var
HGX066529 IRAK166F09 pCMV-SPORT6 BC073833 NM_002807 Partial/var
HGY082819 IRAL007A19 pOTB7 BC001053 NM_002807 Partial/var
HGY091387 IRAL028H19 pOTB7 BC014013 NM_002807 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276535 ARiS191F15 pGCAP10 NM_002807.2  
GGGAGGCGACTGACTGAGCAGCGCACCCGGGGAGCAAGGAGGCGCGGTGAACTGAGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl