Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08188

HP ID(1) HP08188
Gene ID(2) 51106
Gene Symbol finder TFB1M
Protein Name transcription factor B1, mitochondrial
RefSeq NM_016020.2
Length of RefSeq (bp) 1289
Chromosome 6q25.1-q25.3
Reference DDBJ accession
UniGene Hs.279908

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191D05 pGCAP10 GGCGGCGGTGAAGGTCCTGGGTGAGGTAGGGGTGGATGGTGCTTGCCGCGTATCATGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl