DNA Bank Top |  KEGG KO K15266 > 

RIKEN DNA Bank Human Resource - TFB1M

Gene ID NCBI Gene 51106 |  KEGG hsa:51106
Gene Symbol TFB1M
Protein Name transcription factor B1, mitochondrial
Synonyms CGI-75|CGI75|mtTFB|mtTFB1

Link

Ortholog resource in our bank

  TFB1M

External database

human TFB1M

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB17344 pEF6-FLAG-human TFB1M Expression vector of human TFB1M tagged with FLAG at N-terminus.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094623 IRAL036J07 pDNR-LIB BC017788 NM_016020 Full/var
HGY099224 IRAL048A24 pDNR-LIB BC054007 NM_016020

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276477 ARiS191D05 pGCAP10 NM_016020.2  
GGCGGCGGTGAAGGTCCTGGGTGAGGTAGGGGTGGATGGTGCTTGCCGCGTATCATGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl