Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08184

HP ID(1) HP08184
Gene ID(2) 80727
Gene Symbol finder TTYH3
Protein Name tweety homolog 3 (Drosophila)
RefSeq NM_025250.2
Length of RefSeq (bp) 4838
Chromosome 7p22
Reference DDBJ accession
UniGene Hs.440899

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191B11 pGCAP10 GGNGNNNNGNNTTAANNNNNNNNNNNGCGGGCGCGGGCGGCCGAGCGGAGCCGAGCGCAT
RBd91D03 pGCAP10 GGGCGGCGAACAAAGAGGCGGCGGGCGCGGGCGGCCGAGCGGAGCCGAGCGCAGCCGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl