Prev. |  KEGG KO K22641 > 

RIKEN DNA Bank Human Resource - TTYH3

Gene ID NCBI Gene 80727 |  KEGG hsa:80727
Gene Symbol TTYH3
Protein Name tweety family member 3
Synonyms -
Ortholog resource in our bank

  TTYH3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097858 IRAL044K18 pOTB7 BC041603 NM_025250
HGY101823 IRAL054J07 pOTB7 BC069027 NM_025250

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276435 ARiS191B11 pGCAP10 NM_025250.2  
GGNGNNNNGNNTTAANNNNNNNNNNNGCGGGCGCGGGCGGCCGAGCGGAGCCGAGCGCAT
HKR396475 RBd91D03 pGCAP10 NM_025250.2  
GGGCGGCGAACAAAGAGGCGGCGGGCGCGGGCGGCCGAGCGGAGCCGAGCGCAGCCGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl