Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08134

HP ID(1) HP08134
Gene ID(2) 9786
Gene Symbol finder KIAA0586
Protein Name KIAA0586
RefSeq NM_014749.3
Length of RefSeq (bp) 5600
Chromosome 14q23.1
Reference DDBJ accession
UniGene Hs.232532

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS150F05 pGCAP10 GATTGTTGCTCCTGTGGCCATTCTCTTGTCATCCCCACTTTCACATTTTGGCGTGGTGTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl