Prev. | 

RIKEN DNA Bank Human Resource - KIAA0586

Gene ID NCBI Gene 9786 |  KEGG hsa:9786
Gene Symbol KIAA0586
Protein Name KIAA0586
Synonyms JBTS23|SRTD14|Talpid3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001497 IRAK003M09 pCMV-SPORT6 BC000900 NM_014749 Partial
HGX056337 IRAK140O01 pCMV-SPORT6 BC066647 NM_014749 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113614 M01C084A14 pDONR221 IMS05-F07 BC066647 ENST00000261244  
HGE113662 M01C084C14 pDONR221 IMS05-F07 BC066647 ENST00000261244  
HGE113710 M01C084E14 pDONR221 IMS05-F07 BC066647 ENST00000261244  
HGE113758 M01C084G14 pDONR221 IMS05-F07 BC066647 ENST00000261244  
HGE113806 M01C084I14 pDONR221 IMS05-F07 BC066647 ENST00000261244  
HGE113854 M01C084K14 pDONR221 IMS05-F07 BC066647 ENST00000261244  
HGE113902 M01C084M14 pDONR221 IMS05-F07 BC066647 ENST00000261244  
HGE113950 M01C084O14 pDONR221 IMS05-F07 BC066647 ENST00000261244  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR260125 ARiS150F05 pGCAP10 NM_014749.3  
GATTGTTGCTCCTGTGGCCATTCTCTTGTCATCCCCACTTTCACATTTTGGCGTGGTGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl