Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08109

HP ID(1) HP08109
Gene ID(2) 51236
Gene Symbol finder C8orf30A
Protein Name chromosome 8 open reading frame 30A
RefSeq NM_016458.2
Length of RefSeq (bp) 2441
Chromosome 8q24.3
Reference DDBJ accession
UniGene Hs.300224

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS122G14 pGCAP10 GGCTCCTCTGGTGGGCGGGGTTGCGGGCCACACAGCGGACCCCTAAGCGGACCGCTGGCA
RBd58G08 pGCAP10 GACCGGTCGGGTGGCAGCAGAGTGTCGCTCGACATGGGGGNNNNNNNGGCTGGCGCTGGC
RBdS014B11 pGCAP10 GAGAGTGTCGCTCGACATGGGGGAGGCCGGGGCTGGCGCTGGCGCCTCGGGAGGGCCGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl