Prev. | 

RIKEN DNA Bank Human Resource - HGH1

Gene ID NCBI Gene 51236 |  KEGG hsa:51236
Gene Symbol HGH1
Protein Name HGH1 homolog
Synonyms BRP16|BRP16L|C8orf30A|C8orf30B|FAM203A|FAM203B
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008121 IRAK020F01 pCMV-SPORT6 BC015471 NM_016458 Partial/var
HGY080831 IRAL002B07 pOTB7 BC009915 NM_016458 Full
HGY083739 IRAL009F19 pOTB7 BC003035 NM_016458

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR248958 ARiS122G14 pGCAP10 NM_016458.2  
GGCTCCTCTGGTGGGCGGGGTTGCGGGCCACACAGCGGACCCCTAAGCGGACCGCTGGCA
HKR383352 RBd58G08 pGCAP10 NM_016458.2  
GACCGGTCGGGTGGCAGCAGAGTGTCGCTCGACATGGGGGNNNNNNNGGCTGGCGCTGGC
HKR405635 RBdS014B11 pGCAP10 NM_016458.2  
GAGAGTGTCGCTCGACATGGGGGAGGCCGGGGCTGGCGCTGGCGCCTCGGGAGGGCCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl