Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08104

HP ID(1) HP08104
Gene ID(2) 23061
Gene Symbol finder TBC1D9B
Protein Name TBC1 domain family, member 9B (with GRAM domain)
RefSeq NM_198868.2
Length of RefSeq (bp) 5189
Chromosome 5q35.3
Reference DDBJ accession
UniGene Hs.155829

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS122C22 pGCAP10 GGCTCCGGGACGCCGACGGCGGCGGGCGCTTCCGCCTCGCGGGCCTCGGCCCGGTGCGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl