Prev. |  KEGG KO K19951 > 

RIKEN DNA Bank Human Resource - TBC1D9B

Gene ID NCBI Gene 23061 |  KEGG hsa:23061
Gene Symbol TBC1D9B
Protein Name TBC1 domain family member 9B
Synonyms GRAMD9B
Ortholog resource in our bank

  TBC1D9B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14993 pEGFP-C1-human TBC1D9B Expression vector of human TBC1 domain family member 9B (TBC1D9B), fused with N-terminal EGFP, CMV promoter.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069820 IRAK174J04 pCMV-SPORT6 BC080659 NM_015043 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR248870 ARiS122C22 pGCAP10 NM_198868.2  
GGCTCCGGGACGCCGACGGCGGCGGGCGCTTCCGCCTCGCGGGCCTCGGCCCGGTGCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2023.04.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl