Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08070

HP ID(1) HP08070
Gene ID(2) 388524
Gene Symbol finder RPSAP58
Protein Name ribosomal protein SA pseudogene 58
RefSeq NR_003662.2
Length of RefSeq (bp) 1397
Chromosome 19p12
Reference DDBJ accession
UniGene Hs.560655

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS118A12 pGCAP10 GAGAGTTTGGGATCGGTCTCTTCTGTTCCGCGTCCTCCACCTCGGTAGCCCCTGGTGACT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl