Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08066

HP ID(1) HP08066
Gene ID(2) 7109
Gene Symbol finder TRAPPC10
Protein Name trafficking protein particle complex 10
RefSeq NM_003274.4
Length of RefSeq (bp) 6970
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.126221

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096M17 pGCAP10 GGCTGANGCCGGCAGCAGCGGGCGNCANCTGCGGCGCAACCGGCTCCGGAGCTGCCTGGC
RBd80C06 pGCAP10 TTAAATCTTTTAAATTCTTACTTGAAATGGTATTACCTCAGATCTGTTCATTTTAAAATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl