Prev. |  KEGG KO K20307 > 

RIKEN DNA Bank Human Resource - TRAPPC10

Gene ID NCBI Gene 7109 |  KEGG hsa:7109
Gene Symbol TRAPPC10
Protein Name trafficking protein particle complex 10
Synonyms EHOC-1|EHOC1|GT334|TMEM1|TRS130|TRS30
Ortholog resource in our bank

  TRAPPC10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238705 ARiS096M17 pGCAP10 NM_003274.4  
GGCTGANGCCGGCAGCAGCGGGCGNCANCTGCGGCGCAACCGGCTCCGGAGCTGCCTGGC
HKR392054 RBd80C06 pGCAP10 NM_003274.4  
TTAAATCTTTTAAATTCTTACTTGAAATGGTATTACCTCAGATCTGTTCATTTTAAAATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl