Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08063

HP ID(1) HP08063
Gene ID(2) 81555
Gene Symbol finder YIPF5
Protein Name Yip1 domain family, member 5
RefSeq NM_001024947.2
Length of RefSeq (bp) 3461
Chromosome 5q32
Reference DDBJ accession
UniGene Hs.372050

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096L02 pGCAP10 GGACACGTAGCAACGGGGCTGGTTCAGGGTCTGAAACAGAGTTTGGGGGTTGTTTGGGAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl