Prev. |  KEGG KO K20363 > 

RIKEN DNA Bank Human Resource - YIPF5

Gene ID NCBI Gene 81555 |  KEGG hsa:81555
Gene Symbol YIPF5
Protein Name Yip1 domain family member 5
Synonyms FinGER5|SB140|SMAP-5|SMAP5|YIP1A
Ortholog resource in our bank

  YIPF5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX017096 IRAK042M08 pCMV-SPORT6 BC024737 NM_030799 Full
HGY088016 IRAL020A16 pOTB7 BC007829 NM_030799 Full
HGY092330 IRAL030N18 pOTB7 BC014253 NM_030799 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238666 ARiS096L02 pGCAP10 NM_001024947.2  
GGACACGTAGCAACGGGGCTGGTTCAGGGTCTGAAACAGAGTTTGGGGGTTGTTTGGGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl