Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08056

HP ID(1) HP08056
Gene ID(2) 84720
Gene Symbol finder PIGO
Protein Name phosphatidylinositol glycan anchor biosynthesis, class O
RefSeq NM_152850.2
Length of RefSeq (bp) 2459
Chromosome 9p13.3
Reference DDBJ accession
UniGene Hs.522099

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096H03 pGCAP10 CGGCCGGCCGATGACTTCCGGGTGCCATTGCAGGATGCAGAAAGCCTCAGTGTTGCTCTT
RBdS083F15 pGCAP10 GACTTCCGGGTGCCATTGCAGACTCTAGTGCAGTGGTTCAATCTCGGCTCACTGCAACCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl