Prev. |  KEGG KO K05288 > 

RIKEN DNA Bank Human Resource - PIGO

Gene ID NCBI Gene 84720 |  KEGG hsa:84720
Gene Symbol PIGO
Protein Name phosphatidylinositol glycan anchor biosynthesis class O
Synonyms HPMRS2
Ortholog resources KEGG ortholog (KEGG orthology K05288) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX020827 IRAK052B03 pCMV-SPORT6 BC029271 NM_152850 Partial/var
HGX031328 IRAK078F08 pCMV-SPORT6 BC036916 NM_152850 Full
HGX056367 IRAK140P07 pCMV-SPORT6 BC065282 NM_152850 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE038567 W01A096G23 pENTR-TOPO IRAK140P07 BC065282 NM_152850  
HGE038597 W01A096I05 pENTR-TOPO IRAK140P07 BC065282 NM_152850  
HGE038599 W01A096I07 pENTR-TOPO IRAK140P07 BC065282 NM_152850  
HGE038603 W01A096I11 pENTR-TOPO IRAK140P07 BC065282 NM_152850  
HGE038607 W01A096I15 pENTR-TOPO IRAK140P07 BC065282 NM_152850  
HGE038615 W01A096I23 pENTR-TOPO IRAK140P07 BC065282 NM_152850  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR238571 ARiS096H03 pGCAP10 NM_152850.2  
CGGCCGGCCGATGACTTCCGGGTGCCATTGCAGGATGCAGAAAGCCTCAGTGTTGCTCTT
HKR433335 RBdS083F15 pGCAP10 NM_152850.2  
GACTTCCGGGTGCCATTGCAGACTCTAGTGCAGTGGTTCAATCTCGGCTCACTGCAACCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl