Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08036

HP ID(1) HP08036
Gene ID(2) 5365
Gene Symbol finder PLXNB3
Protein Name plexin B3
RefSeq NM_005393.1
Length of RefSeq (bp) 6145
Chromosome Xq28
Reference DDBJ accession
UniGene Hs.632833

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS088M04 pGCAP10 ACAAAATAGGGACACTGTCTTTGTCCCTCCTTATGTCCCCCTCTCTCTGTGCCCCCTCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl