Prev. |  KEGG KO K06821 > 

RIKEN DNA Bank Human Resource - PLXNB3

Gene ID NCBI Gene 5365 |  KEGG hsa:5365
Gene Symbol PLXNB3
Protein Name plexin B3
Synonyms PLEXB3|PLEXR|PLXN6
Ortholog resources KEGG ortholog (KEGG orthology K06821) in the DNA Bank
Featured content Axon guidance - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235492 ARiS088M04 pGCAP10 NM_005393.1  
ACAAAATAGGGACACTGTCTTTGTCCCTCCTTATGTCCCCCTCTCTCTGTGCCCCCTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl