Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PLXNB3

Gene ID (NCBI) 5365
Gene Symbol PLXNB3
Protein Name plexin B3
Synonyms PLEXB3|PLEXR|PLXN6
Databases KEGG hsa:5365 |  NCBI Gene 5365
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06821)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235492 ARiS088M04 pGCAP10 NM_005393.1  
ACAAAATAGGGACACTGTCTTTGTCCCTCCTTATGTCCCCCTCTCTCTGTGCCCCCTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl